DNA damage-triggered activation of cGAS-STING pathway induces apoptosis in human keratinocyte HaCaT cells

Can Li, Weiwei Liu, Fang Wang, Toshihiko Hayashi, Kazunori Mizuno, Shunji Hattori, Hitomi Fujisaki, Takashi Ikejima
a Wuya College of Innovation, Shenyang Pharmaceutical University, Shenyang, 110016, Liaoning, PR China
b Key Laboratory of Computational Chemistry-Based Natural Antitumor Drug Research & Development, Liaoning, PR China
c Department of Chemistry and Life Science, School of Advanced Engineering, Kogakuin University, 2665-1, Nakanomachi, Hachioji, Tokyo, 192-0015, Japan
d Nippi Research Institute of Biomatrix, Toride, Ibaraki, 302-0017, Japan

A B S T R A C T
EXposure to ultraviolet B (UVB) from sunlight causes DNA damage, serious cellular inflammation and aging, and even cell death in the skin, commonly known as sunburn, leading to cutaneous tissue disorders. DNA damage can be sensed as a danger-associated molecular pattern (DAMP) by the innate immune system. It has not been studied, however, whether cGAS-STING activation is involved in the apoptosis induced by UVB irradiation or by cisplatin treatment. Here we report the findings that within hours of DNA damages keratinocytes show an innate immune response, which involves the activation of cGAS-STING; a cytosolic DNA receptor, cGAS (cyclic gua- nosine monophosphate-adenosine monophosphate synthase), cyclic GMP-AMP (cGAMP) synthase, and DNA sensing adaptor, STING (protein stimulator of interferon genes). Either UVB irradiation or cisplatin treatment can cause DNA damages, releasing fragmented DNA from nucleus and/or mitochondria. Roles of cGAS-STING were examined in the HaCaT cells with DNA damages caused by UVB irradiation or cisplatin treatment. Silencing STING by siRNA rescued HaCaT cells from UVB or cisplatin-induced apoptosis. NF-κB, one of the major downstream components of STING pathway, which usually regulates the classical STING apoptotic pathway, was translocated to nucleus in the HaCaT cells irradiated with UVB. This translocation was attenuated by STING silencing. Treatment with BAY, an inhibitor of NF-κB pathway, blocked UVB-induced apoptosis. cGAS-STING- mediated production of IFNβ was induced by nuclear translocation of interferon regulatory factor 3 (IRF3). UVB irradiation inceased the nuclear translocation of IRF3, accompanied by enhanced expression level of IFNβ mRNA. The nuclear translocation of IRF3 and expression of IFNβ mRNA were attenuated by STING silencing. Treatment with MRT67307, an inhibitor of TBK1-IRF3-IFNβ pathway, blocked UVB-induced apoptosis. There-fore, we conclude that NF-κB pathway and IFNβ pathway residing in the downstream of STING are resposible forapoptosis of UVB-irradiated or cisplatin-treated HaCaT cells.

1. Introduction
Solar ultraviolet (UV) radiation damages DNA, proteins and lipids, resulting in harmful consequences such as carcinogenesis, aging and programmed cell death (Bernard et al., 2019; Otkur et al., 2018). Revealing the precise mechanism of programmed cell death initiation would help us understand skin homeostasis and thus to make strategiesfor minimizing damages.
The outer epidermal skin is a primary barrier that protects the body from harmful extrinsic factors such as ultraviolet radiation, chemicals and pollutants (Zhu et al., 2016). The innate immune system against invading pathogens provides a rapid initial defense program that relies on the recognition of pathogen-associated molecular patterns (PAMPs) to shape local immune response. Innate immune activation can also bobserved in the absence of infection, following the detection of danger-associated molecular patterns (DAMPs) after injury or during sterile inflammation. PAMPs and DAMPs are detected by the pattern recognition receptors that induce apoptosis, involving expression of cytokines and chemokines. Intracellular DNA receptors recognize double-stranded (ds) DNA as a PAMP during infection with DNA viruses and other intracellular pathogens. They can also detect self-DNA as DAMP under some circumstances, for instance, when damaged DNA has leaked into the cytosol (Dhanwani et al., 2018). Cyclic GMP-AMP (cGAMP) synthase (cGAS) is a cytosolic DNA sensor and acts as a specific second messenger to activate the protein stimulator of inter- feron genes (STING). cGAS-mediated activation of STING is crucial for the detection of DNA from intracellular pathogens as well as the damaged self-DNA leaked from cellular nucleus and mitochondria into the cytosol (Mackenzie et al., 2017). Activation of cGAS pathway by aberrant recognition of self-DNA leads to autoimmune and inflamma- tory diseases (Chen et al., 2016). Following activation, STING trans- locates from endoplasmic reticulum to signaling compartments, where STING associates with NF-κB as well as TBK1 (TANK binding kinase 1) that mediates activation of the transcription factor interferon regulatory factor 3 (IRF3) (Abe and Barber, 2014). Both NF-κB and IRF3 are required for eliciting the pathophysiological function of STING.
Whether cGAS-STING activation contributes to UVB-induced apoptosis has not been fully investigated. Therefore, we explored whether activation of STING has a role in programmed cell death of epidermal cells by the treatment of immortalized human keratinocyte, HaCaT cells, with UVB irradiation.
In this study, we show that DNA damage induced by UVB-irradiation or cisplatin-treatment activates the cGAS-STING pathway, leading to apoptosis.

2. Methods and materials
2.1. Cells and culture
Human immortalized keratinocyte HaCaT cells (CLS Cell Lines Ser- vice, 300,493) were cultured in high glucose Dulbecco’s Modified Eagle Medium (DMEM, Gibco by life technology, Grand Island, NY, USA) supplemented with 10 % certified fetal bovine serum purchased from TBD Science (Tianjin, China), 100 μg/mL of streptomycin and 100 U/mLof penicillin. Cells were incubated at 37 ◦C with 5 % CO2 in a humidifiedatmosphere.

2.2. UVB exposure
HaCaT cells were irradiated with UVB at a dosage of 20 mJ/cm2 or the indicated dosages. UVB lamps (Beijing Lighting Research Institute, Beijing, China) emit UVB radiation from 280 to 340 nm with a peak wavelength at 314 nm. UVB intensity was measured by using a UVB spectra radiometer (Photoelectric Instrument Factory of Beijing Normal University, Beijing, China). To avoid possible UVB absorption by the proteins and other components in the medium, cell layers were washed with PBS twice and covered by 1 mL of PBS/well in 6-well plates when exposed to UVB irradiation.

2.3. Reagents
The primary antibodies against cGAS, STING, IRF3, γ-H2AX and lamin B were obtained from Cell Signal Technology (Boston, MA, USA). The primary antibodies against NF-κB p65, IκB, PARP (poly ADP-ribose polymerase) and β-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT), 4′,6-diamidino-2-phenylindole (DAPI) andHoechst 33,342 were obtained from Sigma Chemical (St. louis, MO, USA). BAY 11–7082 (BAY), MRT67307 and anacardic acid were from MedChem EXpress (Monmouth Junction, NJ, USA).

2.4. Cell viability assay
HaCaT cells were seeded in 96-well plates at the density of 1.4 10 (Dhanwani et al., 2018) cells per well and cultured for 24 h. Then the cells were subjected to predetermined treatments for 12 h or the indi- cated time periods. Afterwards, the cells were washed once with PBS, and incubated with 100 μL of 0.5 mg/mL MTT dissolved in media at 37◦C for 2 4 h. Then 150 μL of dimethyl sulfoXide (DMSO) was added toeach well after removing the supernatant, and the optical density was measured at the wavelength of 492 nm with a microplate reader (Thermal Fisher Scientific, MA, USA). Cell viability was calculated using the formula below:
Relative cell numbers (%) = 100 × (A492, sample — A492, blank) / (A492, control —A492, blank)

2.5. Hoechst 33342 staining
HaCaT cells (8 105/well) were cultured in 6-well plates. After 24 h of incubation, the cells were subjected to the indicated treatments for 12h. The cells were fiXed in 4 % paraformaldehyde for 20 min, and then the cells were incubated with 500 μL of 5 μg/ml Hoechst 33342 at room temperature in the dark for 20 min. Cell nuclear images were observed with a fluorescence microscope (Olympus, Tokyo, Japan).

2.6. Annexin V-FITC/propidium iodide (PI) assa
The Annexin V-FITC/PI staining (Wanleibio, Shenyang, Liaoning, China) assay was used to analyze cell apoptosis according to the man- ufacturer’s protocol. In brief, a total of 8 105 cells were seeded in 6-well dishes and cultured for 24 h followed by indicated treatments for 12 h. Then the cells were harvested and re-suspended in binding buffer. The cells were stained with 10 μg/ml Annexin V-FITC at room temper- ature for 5 min, and with 5 μg/ml PI at room temperature for 15 min. A FACS Calibur flow cytometer and Flowjo software (Becton-Dickinson, Mansfield, MA, USA) were used to analyze apoptotic cells.

2.7. Nuclear and cytoplasmic protein extraction
Cells were collected 12 h after the indicated treatments and lysed. Nuclear. A cytoplasmic protein extraction kit purchased from Wanleibio (Shenyang, Liaoning, China) was used for fractionation. Harvested cells were first suspended with 100 μL of cytoplasmic protein extraction re- agent A supplemented with 1 mM phenylmethylsulfonyl fluoride(PMSF) and 1 mM dithiothreitol (DTT), and incubated at 4 ◦C for 10 min.
Then 5 μL of cytoplasmic protein extraction reagent B was added and incubated for 1 min. After centrifugation at 12,000 g for 5 min, the supernatants were collected as the cytoplasmic protein extract, and the remaining precipitate was used as the nuclear fraction. For preparation for nuclear protein extraction, 50 μL of nuclear protein extraction re-agent C containing 1 mM PMSF and 1 mM DTT was added to the pre- cipitate and incubated at 4 ◦C for 30 min after resuspension.
Supernatants were centrifuged at 12,000 g for 10 min, and was collected as the nuclear protein extract. The collected cytoplasmic and nuclear protein extracts were then subjected to western blotting.

2.8. Whole cell protein extraction
Both adherent and floating cells were collected 12 h after the indi- cated treatments, and lysed with RIPA lysis buffer (Beyotime, Haimen, Jiangsu, China) supplemented with PMSF and DTT. After 30 min of incubation, the supernatant collected after centrifugation was subjected to western blotting.

2.9. Western blotting
After determination of the protein concentration, lysates were miXed with 5 × loading buffer, and denatured by boiling for 5 min. The samples were then loaded on an SDS-PAGE with 10–12 % gradient gel andsubsequently transferred onto Millipore Immobilon®-P Transfer Mem- brane (Merk KGaA, Darmstadt, Germany). The blots were blocked with 5 % nonfat milk in Tris-buffer saline plus 0.1 % Tween 20 and incubated sequentially with primary antibodies, followed by the further incubation with the corresponding horseradish-peroXidase-conjugated secondary antibodies. Then the SuperSignal® West Pico Chemiluminescent Sub- strates (Thermal Fisher Scientific, MA, USA) were used to generate fluorescent signals.

2.10. Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was extracted using RNAiso Plus reagent (TaKaRa, Shiga, Japan) according to the protocol. Then the cDNA reverse transcription from the total RNA was performed using PrimeScript™ RT Master MiX (TaKaRa, Shiga, Japan). Subsequently, the synthesized cDNA was amplified with the corresponding PCR primers using TB Green® Premix Ex Taq™ (TaKaRa). Sequences of the primers are listed as follows: GADPH, F: ACCCACTCCTCCACCTTTG, R: ATCTTGTGCTCTTGCTGGG. IFNβ, F: CGCCGGCATTGACCATCTA, R: GACATTAGCCAG- GAGGTTCTCA. cGAS, F: AAGGATAGCCGCCATGTTTCT, R: TGGCTTTCAGCAAAAGTTAGG. STING, F: AGCATTACAA- CAACCTGCTACG, R: GTTGGGGTCAGCCATACTCAG. The amplifyingprogram was set as follows: initial denaturation at 95 ◦C for 30 s; 40cycles of 95 ◦C for 5 s and 60 ◦C for 30 s; followed by a melt curve step. Quantification cycle (Cq) for the mRNAs of interest were normalized to GADPH reference mRNA. Data are expressed as fold change over mock treatment.

2.11. Transfection of small interfering RNAs (siRNAs)
The siRNAs used in this study were all synthesized by Gene Pharma (Suzhou, China). Cells were transfected with siRNA oligonucleotides using lipofectamine 2000 reagent (Invitrogen, CA, USA) according to themanufacturer’s instructions. The siRNA sequences used in this study were as follows: si-STING,5′-GCCUCAUUGCCUACCAGGATT-3′ and the negative control (si-Control): 5′-UUCUCGGAAGGUGUCACGUTT-3′.

2.12. Immunofluorescent staining
Cells grown on coverslips were fiXed in 4 % paraformaldehyde for 30 min, permeabilized with 0.15 % Triton X-100 for 8 min, blocked with 10% FBS at room temperature for 30 min, followed by overnight incuba- tion with anti-NF-κB p65 antibody (1:100) (Wanleibio, Shenyang, China) or anti-IRF3 antibody (1:100) (Santa Cruz, CA, USA) at 4 ◦C. Thecoverslips were washed with TBST and further incubated with fluorochrome-conjugated secondary antibodies (1:200 dilution) (Key- GEN, Jiangsu, China) at room temperature for 2 h. The coverslips were washed with TBST three times to remove the excess antibody and stained with DAPI for 7 min. After removing the excess DAPI, the cov-erslips were mounted on slides with a drop of mounting medium and stored in the dark at 4 ◦C. Images were captured using a confocal mi- croscope (Nikon C2 plus, Tokyo, Japan).

2.13. Statistical analysis
Data are expressed as means SD of at least three independent ex- periments. Statistical differences among individual groups were deter- mined using one-way ANOVA followed by t-test All analyses were done using Graphpad Prism 8.0 statistical software. The results are consideredsignificantly different when P < 0.05.

3. Results
3.1. DNA damage caused by UVB irradiation results in HaCaT cell death in association with up-regulation of γ-H2AXHaCaT cells were treated with UVB doses ranging from 0 to 40 mJ/ cm2. MTT assay showed that the cell numbers were reduced to a half at 12 h, when irradiated with UVB at the dose of 20 mJ/cm2 (Fig. 1A). ThisUVB dosage was used in the following study. DNA damage is one of well- known causes for the induction of cell death. DNA is strictly compart- mentalized within the nucleus to prevent autoimmunity. However, in case of DNA damage, the self-DNA leaks from the nucleus or mito- chondria into the cytoplasm. cGAS, a cytosolic sensor of double-stranded DNA, detects the leaked DNA (Mackenzie et al., 2017). The transcrip- tional response to DNA damage correlates well with induction of the phosphorylated histone γ-H2AX which has been used to assess DNA damage in UVB-irradiated cells (Marabini et al., 2020; Dunphy et al., 2018). In our study, UVB irradiation causes DNA damage in HaCaT cells, as indicated by the up-regulation of γ-H2AX (Fig. 1), consistent with the previous reports (Sun et al., 2018). Cells harvested at different time points after UVB irradiation were lysed and analyzed by western blot-ting. The protein expression of γ-H2AX increased time-dependently (1—12 h and even 10—60 min) on UVB irradiation (Fig. 1B and 1C). The protein expression of γ-H2AX also increased in response to UVB irradiation (0—40 mJ/cm2) (Fig. 1D). Interestingly, both the intra- and extra-nuclear levels of γ-H2AX increased by UVB irradiation (Fig. 1E).
Additionally, the mitochondrial and extra-mitochondrial levels of γ-H2AX increased as well by UVB irradiation (Fig. 1F), indicating that both nuclear and mitochondrial DNA were damaged by UVB irradiation. We conclude that UVB irradiation causes DNA damages and release of the fragmented DNA from nucleus and mitochondria time- and dose-dependently.

3.2. cGAS-STING is indispensable for UVB-induced apoptosis
Considering that released DNA from nuclear and mitochondria caused toXicity in HaCaT cells, we tested whether the DNA-sensing adaptor, cGAS-STING, is involved in the acute cell death caused by UVB irradiation (Jiang et al., 2020). Firstly, we determined the mRNA levels of cGAS and STING after UVB irradiation by RT-PCR (Fig. 2A and 2B). We next examined changes of cGAS and STING protein expressionlevels by western blot assays in response to UVB irradiation (0~40 mJ/cm2). We found that both cGAS and STING were induced in HaCaT cells UVB dose-dependently (Fig. 2C). The expressions of cGAS andSTING also time-dependently increased, after UVB treatment (Fig. 2D). To verify that UVB-induced HaCaT cell apoptosis is indeed dependent on STING, we transfected HaCaT cells with siRNA targeting STING. Then the protein expression of STING was examined by western blot analysis (Fig. 2E). As expected, cell viability data show that silencing STING significantly attenuated UVB-induced cell death (Fig. 2F). Apoptosis is executed by activated caspase-3, which cleaves poly ADP-ribose poly- merase (PARP). Western blot results show that silencing STING re- presses the activation of caspase-3 and cleavages of PARP (Fig. 2G). Cell nuclei stained with Hoechst 33,342 show that silencing STING reduced the pyknotic nuclei, a typical apoptotic feature (Fig. 2H). Apoptosis was evaluated using Annexin V/propidium iodide (AV/PI) staining and silencing STING is found to significantly attenuate apoptosis (Fig. 2I). These results indicate that UVB-induced apoptosis is mediated through STING pathway.

3.3. UVB irradiation activates NF-κB pathway through STING
cGAS-STING-dependent apoptosis is reported to be mediated by NF- κB, a major component in the DNA damage pathway (Zierhut et al., 2019). We previously reported on the NF-κB translocation and the expression of IκB, inhibitor of NF-κB translocation, in UVB-irradiatedHaCaT cells (Otkur et al., 2018). Therefore, we examined the involve- ment of NF-κB in STING-dependent apoptosis of UVB-irradiated HaCaT cells. The translocation of NF-κB and the expression of IκB were analyzed. Results from western blot assay and immunofluorescence confocal microscopy show that UVB irradiation enhanced nuclear translocation of NF-κB in the HaCaT cells (Fig. 3A and B). We examined the whole cell protein expression of IκB and found it was significantly reduced in UVB-irradiated HaCaT cells (Fig. 3C), confirming the acti- vation of NF-κB pathway. Silencing STING caused down-regulation of the nuclear translocation of NF-κB in UVB-irradiated cells (Fig. 3D), indicating that NF-κB activation in UVB -irradiated HaCaT cells is the consequence of STING activation. Silencing STING kept original IκBlevel in the UVB-treated cells (Fig. 3E). Although NF-κB is well known for its anti-apoptotic function, it becomes pro-apoptotic in some cases including UVB irradiation-induced DNA damages (Yamashita and Passegu´e, 2019). Therefore, we examined whether NF-κB pathway activation accounts for UVB-induced apoptosis. BAY 11–7082 (BAY) works as a NF-κB pathway inhibitor by specifically inhibiting IκBα degradation (Irrera et al., 2017). MTT assay shows that cell viability after UVB-irradiation was restored with BAY treatment (Fig. 3F). Western blot assay showed that treatment with BAY also repressed the activation of caspase-3 and cleavages of PARP (Fig. 3G). Staining with the Hoechst 33,342 showed that cells treated with BAY alleviated the apoptotic feature of condensed nucleus (Fig. 3H), confirming thatinhibition of NF-κB pathway abolishes the apoptosis induced by UVB irradiation. These results demonstrate that UVB irradiation induces HaCaT cell apoptosis through STING-mediated NF-κB pathway activation.

3.4. UVB irradiation induces the activation of TBK1-IRF3-IFNβ pathway through STING activation
The key DNA sensor in the cytosol is cGAS, which catalyzes the synthesis of the second messenger cyclic GMP-AMP (cGAMP). cGAMP then binds to the endoplasmic reticulum transmembrane protein STING, which becomes activated and is translocated to the intermediate com- partments between the endoplasmic reticulum and Golgi (Basit et al., 2020; Balka et al., 2020). During translocation, cGAMP recruits TANK binding kinase-1 (TBK1), which phosphorylates STING, leading to recruitment of interferon regulatory factor-3 (IRF3). TBK1 also phos- phorylates IRF3, causing it to dimerize and move into the nucleus, resulting in the induction of a number of immune and inflammatory factors, including type 1 IFNs (Ritter et al., 2020; Kim et al., 2017).
Up-regulation of IRF3-IFNβ pathway occurred after UVB irradiation, as shown by the time- and dose-dependent increase in the expression of IFNβ mRNA (Fig. 4A and B) and the nuclear translocation of IRF3 (Fig. 4C). HaCaT cells lacking STING activity were unable to support the UVB-induced mRNA expression of IFNβ (Fig. 4D). Here, we tried MRT67307, a small compound inhibitor of TBK1 which inhibits IRF3 phosphorylation (Lork et al., 2018; Xu et al., 2020), to test whether inhibition of TBK1 pathway abolishes the apoptosis induced by UVB irradiation. In consistent with our hypothesis, the expression of IFNβ mRNA caused by UVB irradiation was repressed with MRT67307, cofirming the repression of TBK1-IFNβ pathway (Fig. 4E). MTT assays show that UVB-induced cell death is attenuated by MRT67307 (Fig. 4F). Treatment with MRT67307 also repressed the activation of caspase-3 and cleavage of PARP (Fig. 4G). Upon treatment with anacardic acid, another IRF3 pathway inhibitor which specifically inhibits CBP/p300 co-activators (Takahasi et al., 2010), the expression of IFNβ mRNAinduced by UVB irradiation is repressed (Fig. 4H). Cell death (Fig. 4I), the activation of caspase-3 and cleavages of PARP (Fig. 4J) are all alleviated by anacardic acid treatment in UVB-irradiated HaCaT cells.

3.5. Cisplatin induces cGAS-STING-dependent apoptosis
It is well-established that STING is triggered by DNA damage (Chen et al., 2016). Cisplatin, etoposide, ultraviolet radiation and other DNA damaging agents induce nuclear DNA leakage into cytosol that intrin- sically activates STING-dependent cytokine production (Ahn et al., 2014). To examine whether treatment with DNA damaging reagents affects the viability of HaCaT cells, we treated HaCaT cells with cisplatin, one of the traditional DNA damaging reagents. MTT assays showed that cisplatin at concentration of 20 μM induced reduction of cell number (Fig. 5A). Western blot assays and Hoechst staining were carried out to characterize the HaCaT cell death. Western blot results show that cells treated with cisplatin exhibit marked activation of caspase-3, accompanying cleavages of PARP (Fig. 5B). Pyknotic nuclei, typical apoptotic features, are present in cisplatin-treated cells (Fig. 5C), when cell nuclei stained with Hoechst 33,342 were observed with a fluorescent microscope. We next sought to demonstrate whether STING induces apoptosis upon cisplatin treatment. Western blot assays showedthat cisplatin treatment induced DNA damage and cGAS-STING pathway activation in HaCaT cells (Fig. 5D), similar to UVB irradiation. Cisplatin treatment also reduced the levels of IκB and thus activated the nuclear translocation of NF-κB p65 (Fig. 5E and F). Cisplatin also increased the expression of IFNβ mRNA (Fig. 5G). As expected, STING-deficiency mitigated cisplatin-induced apoptosis, as silencing STING inhibits the activation of caspase-3 and cleavages of PARP (Fig. 5H). Collectively, these data show that STING is involved in the process of apoptosis in the HaCaT cells.

4. Discussion
The cGAS-STING pathway is critical for initiating innate immune responses to invading microbial pathogens such as DNA viruses and bacteria (Gao et al., 2013). This pathway can also contribute to auto- immune diseases and irradiation-mediated cell stress through the recognition of endogenous DNA within the cytosol (Zierhut and Funa- biki, 2020). Most recently, one study indicated that the cGAS-STING pathway induced apoptosis upon the recognition of cytosolic chro- matin fragments (Deng et al., 2014). In this study evidence is presented for the mediation through the cGAS-STING pathways in apoptosis in- duction of HaCaT cells by UVB irradiation as well as by cisplatin treat- ment. The cGAS-STING pathway activates the transcription factor TBK1-IRF3 and NF-κB pathways, leading to apoptosis after exposure to the cytosolic DNA leaked from nucleus and/or mitochondria, ulti- mately leading to cell apoptosis. Specific silencing of STING by siRNA, however, does not fully repress cell death, implying that other dsDNA receptors such as TLR9, NLRP3 and AIM2 in keratinocytes (Dhanwani et al., 2018) may as well be involved in UVB-induced cell death. Ac- cording to the recent report, some DNA damaging agents like etoposide induces dsDNA release from keratinocytes nucleus and activates STING in keratinocytes (Dunphy et al., 2018). The activation of NF-κB and TBK1-IRF3 pathways by STING has impacts on innate immune responses by producing IFN and proinflammatory cytokines (Basit et al., 2020). The present investigation was carried out, focusing on the eff ;ect of STING activation on the skin cells aff ;ected by UVB irradiation or by cisplatin treatment that apparently impairs cells. Our previous study indicates that cisplatin, a classical DNA damaging agent, promotes apoptosis by activating cGAS-STING pathway and two inflammatory pathways (Grabosch et al., 2019). Moreover, knocking down of the STING protein represses, apoptosis of HaCaT cells induced by cisplatin treatment. UVB irradiation and cisplatin administration in the present study may represent a model for the situation that damaged dsDNA released into cytosol in keratinocytes leads to cell death.
We observed nuclear translocation of NF-κB after UVB irradiation. It is frequently reported that NF-κB activation exerts anti-apoptotic effect (Yamashita and Passegu´e, 2019). Namely, apoptosis is negatively regulated by NF-κB through inducing the expression of multiple anti-apoptotic genes, and apoptosis occurs when NF-κB activation is compromised (Yamashita and Passegu´e, 2019). The present study demonstrates that UVB-treated HaCaT cells exhibit augmented NF-κB activation, whereas inhibition of NF-κB pathway does not enhance cell death. Weiliang Gao et al. (2019) found that activation of NF-κB can enhance apoptosis induction of human osteosarcoma cells through upregulation of p53, upregulated modulator of apoptosis (PUMA) pro- tein. In the process of UV induced apoptosis of human melanoma cells, Ivanov et al. (Ivanov and Ronai, 2000)found that down-regulation of NF-κB expression is accompanied by a decrease in apoptosis. Moham- mad Raish et al. (Raish et al., 2018) also found that NF-κB can cause cell apoptosis by activating the expression of pro-apoptotic genes. These strongly suggest that UVB-induced apoptosis through a distinct mecha- nism, requiring NF-κB pathway for initiating the apoptosis. Indeed, numerous reports suggest that NF-κB acts as a pro-apoptotic factor(Meylan et al., 2009). In consistent with the present finding that NF-κBactivation is involved in UVB-induced HaCaT cell apoptosis, another report demonstrates that inhibition of NF-κB activation exhibits pro- tective effects on cell survival (Liu et al., 2009). Causing DNA damage treated with UVB irradiation can sensitize melanoma cells to TRAIL-induced cell apoptosis by NF-κB-mediated downregulation of XIAP (Ono et al., 2017). Activation of NF-κB by UVB irradiation re- presses anti-apoptotic genes such as Bcl-Xl, XIAP, A20, Bcl-2, c-FLIP, IAPs, IL-13, TNF-α, TRAF1, IEX (Sorrentino et al., 2019; Wright et al., 2017). Targeted pro-apoptotic factors that NF-κB can directly regulate are Bax, caspase-2, CD95, Fas, FasL, p53, TNF-α, TRAIL (Beyfuss and Hood, 2018; Sun et al., 2019). Pro-apoptotic effects of NF-κB are possibly due to the enhanced transcriptional activation of TNFαautocrine that leads to apoptosis. Researches have shown that pro-apoptotic NF-κB is closely related to DNA damage response (Chen et al., 2020). UVB irradiation enhances the DNA binding activity of NF-κB, resulting in suppression on the transcriptional activity; and thereby, downregulating anti-apoptotic genes (Sun et al., 2018). UVB-induced apoptosis may also depend on some other NF-κB signalingpathways, including pro-apoptotic IKKα and anti-apoptotic IκB, which have also been reported to directly modulate apoptosis (Timucin and Basaga, 2017). In the present study UVB-irradiated HaCaT cells exhibited augmented NF-κB activation, and inhibition of NF-κB pathway does not enhance cell death induction; instead, it promotes cell survival. These strongly suggest that UVB induced apoptosis through a distinctmechanism, requiring NF-κB pathway for initiating the apoptosis. Cytosolic DNA can activate the noncanonical NF-κB pathway in a STING dependent manner (Wu et al., 2019). STING depletion reduces NF-κB nuclear localization and apoptosis.
UVB irradiation stimulates the transcription factor, interferon regu- latory factor 3 (IRF3), and induces apoptosis through the protein STING (stimulator of IFN genes); however, how IRF3 activates apoptosis is unclear. It was reported that apoptosis is activated by IRF3 through at least four pathways. The first pathway is that IRF3 induces apoptosis by activating type 1 interferon at final stage. Peng wang et al. (Wang et al., 2015; Wu et al., 2020) found that the expression of interferon and cell apoptosis are significantly reduced after IRF3 silencing. Liu et al. (2018) found that apoptosis is down-regulated when IFNβ expression is decreased. The second pathway possibly exists in the NLRP3 inflam- masome. Li et al. (2019) found that knocking out IRF3 in mouse car- diomyocytes significantly inhibited NLRP3 inflammasome activity and apoptosis. The third pathway is that IRF3 causes endoplasmic reticulum (ER) stress to induce apoptosis. Tao et al. (2016) found that three in-dicators of ER stress, the expansion of the ER compartment, the splicing of XBP-1 mRNA and the phosphorylation of eIF2α, significantly increase, when IRF3 is activated. Pre-treatment of IRF3 inhibitor reduces the activation of the ER stress indicators, and inhibits apoptosis. The fourth mechanism is the interaction of activated IRF3 and cytoplasmic Bax, leading to mitochondrial damage and ultimately activating apoptosis. Significantly reduced expression of Bax and apoptosis is shown, when IRF3 is blocked (Sharif-Askari et al., 2007; Cui et al., 2016).
IFNβ is classically thought to be important as an adjuvant promoting pro-inflammatory responses in various autoimmune disorders (Lazear et al., 2019). It belongs to the type 1 interferon which induces the transcription of a number of genes after binding to a common receptor. It is involved in cell proliferation, apoptosis and immune recognition through an intracellular signaling cascade (Makowska et al., 2018; Qin et al., 2019). Our study confirms that a new role of IFNβ in regulating inflammatory response after UVB irradiation is promotion of apoptosis. Anti-inflammatory properties of IFNβ have also been shown in other texts (Dhanwani et al., 2018). While UVB irradiation induces IFNβ in normal skin, UVB-induced IFNβ appears to play a notably different role in the skin following injury. First, when UVB irradiation is limited in terms of a low dose or a short time, the increased production of IFNβ causes an anti-inflammatory effect that limits the extent of inflamma- tion. However, the production of interferon gradually decreases with a higher dose and a longer time of ultraviolet irradiation. The differentialeffects of strong and weak UVB exposure suggest that the type or duration of injury is important in determining the inflammatory response. In our study, the STING pathway is implicated in mediating UVB responses. UVB is well known to break DNA. STING can be also activated by self-DNA. Mitochondria and nucleus are the important sources of intracellular DNA (Banoth and Cassel, 2018). After cellular stress, DNA is released into the cytosol and induces the expression of type I IFN genes in a STING-dependent manner. Here is presented the observation that the cells with STING knockdown markedly reduce the expression of IFNβ mRNA. DNA damages with UVB irradiation followed by sequential activation of cGAS and STING is a key pathway in initia- tion of IFNβ expression. Blocking IFNβ pathway prevents both apoptosis and inflammation caused by UVB irradiation (Makowska et al., 2018). In summary, we propose a novel role of a STING-dependent IFNβ response in UVB-induced inflammation and tissue damage. TBK1 inhibitor re- duces IFNβ expression under UVB irradiation. TBK1 inhibitors may provide health benefits for a number of diseases related to STING acti- vation, including autoimmunity (Brenner et al., 2016). More recently, the cell death role of STING activation is reported to be important forwound healing in the skin (Eaglesham et al., 2019). Application of IFNβto the wounded mice or human skin is successful in wound healing (Jiang et al., 2017). Recognition of endogenous dsDNA by STING is an important step in the program of skin barrier repair (Mizutani et al., 2020). However, the present study suggests that when utilizing IFNβ forskin tissue repair, the eff ;ect of UVB irradiation should be considered in order to protect our body from extensive loss of skin cells.
In this work, we describe the STING activation, which results in the induction of an acute innate immune response within hours of UVB- induced apoptosis. The early response to double-strand DNA damage appears to be particularly potent in keratinocytes, where it might serve as an early warning system for DNA damaging induced by UV light or environmental toXins. Therefore, elucidation is required for how NF-κB pathway and IFNβ pathway would be modified by UVB irradiation in order to understand the physiological meaning of the pro-apoptotic cGAS-STING pathway.

References
Abe, T., Barber, G.N., 2014. Cytosolic-DNA-mediated, STING-dependent proinflammatory gene induction necessitates canonical NF-kappaB activation through TBK1. J. Virol. 88, 5328–5341.
Ahn, J., Xia, T., Konno, H., Konno, K., Ruiz, P., Barber, G.N., 2014. Inflammation-driven carcinogenesis is mediated through STING. Nat. Commun. 5, 5166.
Balka, K.R., Louis, C., Saunders, T.L., Smith, A.M., Calleja, D.J., D’Silva, D.B.,Moghaddas, F., Tailler, M., Lawlor, K.E., Zhan, Y., Burns, C.J., Wicks, I.P., Miner, J. J., Kile, B.T., Masters, S.L., De Nardo, D., 2020. TBK1 and IKKε Act Redundantly to Mediate STING-Induced NF-κB Responses in Myeloid Cells. Cell Rep. 31, 107492.
Banoth, B., Cassel, S., 2018. Mitochondria in innate immune signaling. Transl. Res. 202, 52–68.
Basit, A., Cho, M.G., Kim, E.Y., Kwon, D., Kang, S.J., Lee, J.H., 2020. The cGAS/STING/TBK1/IRF3 innate immunity pathway maintains chromosomal stability through regulation of p21 levels. EXp. Mol. Med. 52, 643–657.
Bernard, J.J., Gallo, R.L., Krutmann, J., 2019. Photoimmunology: how ultraviolet radiation affects the immune system. Nat. Rev. Immunol. 19, 688–701.
Beyfuss, K., Hood, D.A., 2018. A systematic review of p53 regulation of oXidative stress in skeletal muscle. RedoX Rep. 23, 100–117.
Brenner, D., Andersen, P., Ludolph, A., Weishaupt, J., 2016. Comment on "Cutting Edge: Inhibiting TBK1 by Compound II Ameliorates Autoimmune Disease in Mice.J. Immunol. 196, 530–531.
Chen, Q., Sun, L., Chen, Z.J., 2016. Regulation and function of the cGAS-STING pathway of cytosolic DNA sensing. Nat. Immunol. 17, 1142–1149.
Chen, D., Ning, F., Zhang, J., Tang, Y., Teng, X., 2020. NF-κB pathway took part in the development of apoptosis mediated by miR-15a and oXidative stress via mitochondrial pathway in ammonia-treated chicken splenic lymphocytes. Sci. Total Environ. 729, 139017.
Cui, Y., Zhao, D., Sreevatsan, S., Liu, C., Yang, W., Song, Z., Yang, L., Barrow, P., Zhou, X., 2016. Mycobacterium bovis Induces Endoplasmic Reticulum Stress Mediated-Apoptosis by Activating IRF3 in a Murine Macrophage Cell Line. Front. Cell. Infect. Microbiol. 6, 182.
Deng, L., Liang, H., Xu, M., Yang, X., Burnette, B., Arina, A., Li, X., Mauceri, H., Beckett, M., Darga, T., Huang, X., Gajewski, T., Chen, Z., Fu, Y., Weichselbaum, R., 2014. STING-dependent cytosolic DNA sensing promotes radiation-induced type I interferon-dependent antitumor immunity in immunogenic tumors. Immunity 41, 843–852.
Dhanwani, R., Takahashi, M., Sharma, S., 2018. Cytosolic sensing of immuno-stimulatory DNA, the enemy within. Curr. Opin. Immunol. 50, 82–87.
Dunphy, G., Flannery, S.M., Almine, J.F., Connolly, D.J., Paulus, C., Jønsson, K.L., Jakobsen, M.R., Nevels, M.M., Bowie, A.G., Unterholzner, L., 2018. Non-canonical Activation of the DNA Sensing Adaptor STING by ATM and IFI16 Mediates NF-κB Signaling after Nuclear DNA Damage. Mol. Cell 71, 745-760.e745.
Eaglesham, J., Pan, Y., Kupper, T., Kranzusch, P., 2019. Publisher Correction: Viral and metazoan poXins are cGAMP-specific nucleases that restrict cGAS-STING signalling. Nature 569, E12.
Gao, D., Wu, J., Wu, Y., Du, F., Aroh, C., Yan, N., Sun, L., Chen, Z., 2013. Cyclic GMP-AMP synthase is an innate immune sensor of HIV and other retroviruses. Science 341, 903–906.
Gao, W., Gao, J., Chen, L., Ren, Y., Ma, J., 2019. Targeting XIST induced apoptosis of human osteosarcoma cells by activation of NF-kB/PUMA signal. Bioengineered 10, 261–270.
Grabosch, S., Bulatovic, M., Zeng, F., Ma, T., Zhang, L., Ross, M., Brozick, J., Fang, Y., Tseng, G., Kim, E., Gambotto, A., Elishaev, E., Edwards, R., Vlad, A., 2019. Cisplatin- induced immune modulation in ovarian cancer mouse models with distinct inflammation profiles. Oncogene 38, 2380–2393.
Irrera, N., Vaccaro, M., Bitto, A., Pallio, G., Pizzino, G., Lentini, M., Arcoraci, V., Minutoli, L., Scuruchi, M., Cutroneo, G., Anastasi, G.P., Ettari, R., Squadrito, F., Altavilla, D., 2017. BAY 11-7082 inhibits the NF-κB and NLRP3 inflammasome pathways and protects against IMQ-induced psoriasis. Clin. Sci. 131, 487–498.
Ivanov, V.N., Ronai, Z., 2000. p38 protects human melanoma cells from UV-induced apoptosis through down-regulation of NF-kappaB activity and Fas expression.Oncogene 19, 3003–3012.
Jiang, Z., Liu, Y., Li, C., Chang, L., Wang, W., Wang, Z., Gao, X., Ryffel, B., Wu, Y., Lai, Y., 2017. IL-36γ induced by the TLR3-SLUG-VDR AXis Promotes wound healing via REG3A. J. Invest. Dermatol. 137, 2620–2629.
Jiang, M., Chen, P., Wang, L., Li, W., Chen, B., Liu, Y., Wang, H., Zhao, S., Ye, L., He, Y., Zhou, C., 2020. cGAS-STING, an important pathway in cancer immunotherapy.
J. Hematol. Oncol. 13, 81.
Kim, J.A., Park, S.K., Seo, S.W., Lee, C.H., Shin, O.S., 2017. STING is involved in antiviral immune response against VZV infection via the induction of type I and III IFN pathways. J. Invest. Dermatol. 137, 2101–2109.
Lazear, H.M., Schoggins, J.W., Diamond, M.S., 2019. Shared and distinct functions of type I and type III interferons. Immunity 50, 907–923.
Li, N., Zhou, H., Wu, H., Wu, Q., Duan, M., Deng, W., Tang, Q., 2019. STING-IRF3contributes to lipopolysaccharide-induced cardiac dysfunction, inflammation, apoptosis and pyroptosis by activating NLRP3. RedoX Biol. 24, 101215.
Liu, X., Shi, S., Ye, J., Liu, L., Sun, M., Wang, C., 2009. Effect of polypeptide from Chlamys farreri on UVB-induced ROS/NF-kappaB/COX-2 activation and apoptosis in HaCaT cells. J. Photochem. Photobiol. B 96, 109–116.
Liu, Y., Lv, J., Liu, J., Liang, X., Jin, X., Xie, J., Zhang, L., Chen, D., Fiskesund, R.,Tang, K., Ma, J., Zhang, H., Dong, W., Mo, S., Zhang, T., Cheng, F., Zhou, Y., Jia, Q.,Zhu, B., Kong, Y., Guo, J., Zhang, H., Hu, Z.W., Cao, X., Qin, F.X., Huang, B., 2018.STAT3/p53 pathway activation disrupts IFN-β-induced dormancy in tumor- repopulating cells. J. Clin. Invest. 128, 1057–1073.
Lork, M., Kreike, M., Staal, J., Beyaert, R., 2018. Importance of Validating Antibodies and Small Compound Inhibitors Using Genetic Knockout Studies-T Cell Receptor-Induced CYLD Phosphorylation by IKKε/TBK1 as a Case Study. Front. Cell Dev. Biol. 6, 40.
Mackenzie, K.J., Carroll, P., Martin, C.A., Murina, O., Fluteau, A., Simpson, D.J., Olova, N., Sutcliffe, H., Rainger, J.K., Leitch, A., Osborn, R.T., Wheeler, A.P., Nowotny, M., Gilbert, N., Chandra, T., Reijns, M.A.M., Jackson, A.P., 2017. cGAS surveillance of micronuclei links genome instability to innate immunity. Nature 548, 461–465.
Makowska, A., Wahab, L., Braunschweig, T., Kapetanakis, N.I., Vokuhl, C., Denecke, B., Shen, L., Busson, P., Kontny, U., 2018. Interferon beta induces apoptosis in nasopharyngeal carcinoma cells via the TRAIL-signaling pathway. Oncotarget 9, 14228–14250.
Marabini, L., Melzi, G., Lolli, F., Dell’Agli, M., Piazza, S., Sangiovanni, E.,
Marinovich, M., 2020. Effects of Vitis vinifera L. leaves extract on UV radiation damage in human keratinocytes (HaCaT). J. Photochem. Photobiol. B 204, 111810.
Meylan, E., Dooley, A.L., Feldser, D.M., Shen, L., Turk, E., Ouyang, C., Jacks, T., 2009. Requirement for NF-kappaB signalling in a mouse model of lung adenocarcinoma. Nature 462, 104–107.
Mizutani, Y., Kanbe, A., Ito, H., Seishima, M., 2020. Activation of STING signaling accelerates skin wound healing. J. Dermatol. Sci. 97, 21–29.
Ono, H., Iizumi, Y., Goi, W., Sowa, Y., Taguchi, T., Sakai, T., 2017. Ribosomal protein S3 regulates XIAP expression independently of the NF-κB pathway in breast cancer cells. Oncol. Rep. 38, 3205–3210.
Otkur, W., Liu, W., Wang, J., Jia, X., Huang, D., Wang, F., Hayashi, T., Tashiro, S.I., Onodera, S., Ikejima, T., 2018. Sub-lethal ultraviolet B irradiation and Poly I:C treatment synergistically induced apoptosis of HaCaT cells through NF-kappaB pathway. Mol. Immunol. 99, 19–29.
Qin, H., Huang, G., Gao, F., Huang, B., Wang, D., Hu, X., Wang, Y., Peng, L., Luo, D., Mo, B., Hu, C., Li, Y., Wang, C., 2019. Diminished stimulator of interferon genes production with cigarette smoke-exposure contributes to weakened anti-adenovirus vectors response and destruction of lung in chronic obstructive pulmonary disease model. EXp. Cell Res. 384, 111545.
Raish, M., Ahmad, A., Ansari, M.A., Alkharfy, K.M., Aljenoobi, F.I., Jan, B.L., Al- Mohizea, A.M., Khan, A., Ali, N., 2018. Momordica charantia polysaccharides ameliorate oXidative stress, inflammation, and apoptosis in ethanol-induced gastritis in mucosa through NF-kB signaling pathway inhibition. Int. J. Biol. Macromol. 111, 193–199.
Ritter, J.L., Zhu, Z., Thai, T.C., Mahadevan, N.R., Mertins, P., Knelson, E.H., Piel, B.P., Han, S., Jaffe, J.D., Carr, S.A., Barbie, D.A., Barbie, T.U., 2020. Phosphorylation of RAB7 by TBK1/IKKε Regulates Innate Immune Signaling in Triple-Negative Breast Cancer. Cancer Res. 80, 44–56.
Sharif-Askari, E., Nakhaei, P., Oliere, S., Tumilasci, V., Hernandez, E., Wilkinson, P., Lin, R., Bell, J., Hiscott, J., 2007. Bax-dependent mitochondrial membrane permeabilization enhances IRF3-mediated innate immune response during VSV infection. Virology 365, 20–33.
Sorrentino, L., Cossu, F., Milani, M., Malkoc, B., Huang, W.C., Tsay, S.C., Ru Hwu, J., Mastrangelo, E., 2019. Structure-activity relationship of NF023 derivatives binding to XIAP-BIR1. ChemistryOpen 8, 476–482.
Sun, Y., Wang, P., Li, H., Dai, J., 2018. BMAL1 and CLOCK proteins in regulating UVB- induced apoptosis and DNA damage responses in human keratinocytes. J. Cell.Physiol. 233, 9563–9574.
Takahasi, K., Horiuchi, M., Fujii, K., Nakamura, S., Noda, N.N., Yoneyama, M., Fujita, T., Inagaki, F., 2010. Ser386 phosphorylation of transcription factor IRF-3 induces dimerization and association with CBP/p300 without overall conformational change. Genes Cells 15, 901–910.
Tao, X., Xie, L., Duan, C., Dai, S., Ren, J., Yan, Y., Shen, J., Lu, H., Ge, J., 2016. Up-regulation of interferon regulatory factor 3 involves in neuronal apoptosis after intracerebral hemorrhage in adult rats. Neurochem. Res. 41, 2937–2947.
Timucin, A.C., Basaga, H., 2017. Pro-apoptotic effects of lipid oXidation products: HNE at the crossroads of NF-κB pathway and anti-apoptotic Bcl-2. Free Radic. Biol. Med. 111, 209–218.
Wang, P., Zhao, W., Zhao, K., Zhang, L., Gao, C., 2015. TRIM26 negatively regulates interferon-β production and antiviral response through polyubiquitination and degradation of nuclear IRF3. PLoS Pathog. 11, e1004726.
Wright, C., Iyer, A.K.V., Yakisich, J.S., Azad, N., 2017. Anti-tumorigenic effects of resveratrol in lung Cancer cells through modulation of c-FLIP. Curr. Cancer Drug Targets 17, 669–680.
Wu, Z., Oeck, S., West, A.P., Mangalhara, K.C., Sainz, A.G., Newman, L.E., Zhang, X.O.,Wu, L., Yan, Q., Bosenberg, M., Liu, Y., Sulkowski, P.L., Tripple, V., Kaech, S.M., Glazer, P.M., Shadel, G.S., 2019. Mitochondrial DNA Stress Signalling Protects the Nuclear Genome. Nat. Metab. 1, 1209–1218.
Wu, J., Zhu, K., Luo, X., Han, Y., Zhang, B., Wang, Z., Dong, S., Zou, X., Chen, X., Liu, H.,Wu, T., Zheng, Z., Xie, Y., Zhao, J., Liu, Y., Wen, Z., Liu, D., Wang, Y., Zheng, S., Huang, X., Jing, C., Yang, G., 2020. PM(2.5) promotes replication of VSV by ubiquitination degradation of phospho-IRF3 in A549 cells. ToXicol. In Vitro 62, 104698.
Xu, X., Kalac, M., Markson, M., Chan, M., Brody, J.D., Bhagat, G., Ang, R.L., Legarda, D., Justus, S.J., Liu, F., Li, Q., Xiong, H., Ting, A.T., 2020. Reversal of CYLD phosphorylation as a novel therapeutic approach for adult T-cell leukemia/ lymphoma (ATLL). Cell Death Dis. 11, 94.
Yamashita, M., Passegu´e, E., 2019. TNF-α coordinates hematopoietic stem cell survivaland myeloid regeneration. Cell Stem Cell 25, 357-372.e357.
Zhu, X., Zeng, X., Zhang, X., Cao, W., Wang, Y., Chen, H., Wang, T., Tsai, H.I., Zhang, R., Chang, D., He, S., Mei, L., Shi, X., 2016. The effects of quercetin-loaded PLGA-TPGS nanoparticles on ultraviolet B-induced skin damages in vivo. Nanomedicine 12, 623–632.
Zierhut, C., Funabiki, H., 2020. Regulation and Consequences of cGAS Activation by Self- DNA. Trends Cell Biol. 30, 594–605.
Zierhut, C., Yamaguchi, N., Paredes, M., Luo, J.D., Carroll, T., Funabiki, H., 2019. The Cytoplasmic DNA Sensor cGAS Promotes Mitotic Cell Death. Cell 178, 302-315.e323.
Sun, C., Chesnokov, V., Larson, G., Itakura, K., 2019. Glucosamine enhances TRAIL- Induced apoptosis in the prostate Cancer cell line MRT67307. Medicines Basel (Basel) 6.